RegistrierenRegistrieren    LoginLogin   FAQFAQ    SuchenSuchen   
Primer designen
 
Neue Frage »
Antworten »
    Foren-Übersicht -> Genetik
Autor Nachricht
philsim



Anmeldungsdatum: 05.07.2017
Beiträge: 1

BeitragVerfasst am: 05. Jul 2017 12:41    Titel: Primer designen Antworten mit Zitat

Meine Frage:
Ich muss PCR Primer für das Protein P62 designen
Sequenz:
ATGGCGTCGC TCACCGTGAA GGCCTACCTT CTGGGCAAGG AGGACGCGGC
GCGCGAGATT CGCCGCTTCA GCTTCTGCTG CAGCCCCGAG CCTGAGGCGG
AAGCCGAGGC TGCGGCGGGT CCGGGACCCT GCGAGCGGCT GCTGAGCCGG
GTGGCCGCCC TGTTCCCCGC GCTGCGGCCT GGCGGCTTCC AGGCGCACTA
CCGCG ATGAGGACGG GGACTTGGTT GCCTTTTCCA GTGACGAGGA ATTGACAATG
GCCATGTCCT ACGTGAAGGA TGACATCTTC CGAATCTACA TTAAAGAGAA
AAAAGAGTGC CGGCGGGACC ACCGCCCACC GTGTGCTCAG GAGGCGCCCC
GCAACATGGT GCACCCCAAT GTGATCTGCG ATGGCTGCAA TGGGCCTGTG
GTAGGAACCC GCTACAAGTG CAGCGTCTGC CCAGACTACG ACTTGTGTAG
CGTCTGCGAG GGAAAGGGCT TGCACCGGGG GCACACCAAG CTCGCATTCC
CCAGCCCCTT CGGGCACCTG TCTGAGGGCT TCTCGCACAG CCGCTGGCTC
CGGAAGGTGA AACACGGACA CTTCGGGTGG CCAGGATGGG AAATGGGTCC
ACCAGGAAAC TGGAGCCCAC GTCCTCCTCG TGCAGGGGAG GCCCGCCCTG
GCCCCACGGC AGAATCAGCT TCTGGTCCAT CGGAGGATCC GAGTGTGAAT
TTCCTGAAGA ACGTTGGGGA GAGTGTGGCA GCTGCCCTTA GCCCTCTGGG
CATTGAAGTT GATATCGATG TGGAGCACGG AGGGAAAAGA AGCCGCCTGA
CCCCCGTCTC TCCAGAGAGT TCCAGCACAG AGGAGAAGAG CAGCTCACAG
CCAAGCAGCT GCTGCTCTGA TCCCAGCAAG CCGGGTGGGA ATGTTGAGGG
CGCCACGCAG TCTCTGGCGG AGCAGATGAG AAAGATCGCC TTGGAGTCCG
AGGGGCGCCC TGAGGAACAG ATGGAGTCGG ATAACTGTTC AGGAGGAGAT
GATGACTGGA CCCATCTGTC TTCAAAAGAA GTGGACCCGT CTACAGGTGA
ACTCCAGTCC CTACAGATGC CAGAATCCGA AGGGCCAAGC TCTCTGGACC
CCTCCCAGGA GGGACCCACA GGGCTGAAGG AAGCTGCCTT GTACCCACAT
CTCCCGCCAG AGGCTGACCC GCGGCTGATT GAGTCCCTCT CCCAGATGCT
GTCCATGGGC TTCTCTGATG AAGGCGGCTG GCTCACCAGG CTCCTGCAGA
CCAAGAACTA TGACATCGGA GCGGCTCTGG ACACCATCCA GTATTCAAAG
CATCCCCCGC CGTTGTAG

Die zu verwendenden Enzyme für die spätere Klonierung: XhoI und KpnI




Meine Ideen:
Die Multiple cloning site befindet sich hinter dem Tag. Daher muss nach dem zu inserierenden Protein ein Stopp Codon folgen.
Forward: ctcgag (XhoI) gccacc (Kozak) ATGGCGTCGCTCACCGTGAA
Reverse: ggtacc (KpnI) CTA (stopp) CAACGGCGGGGGATGCTT

Bin mir nicht ganz sicher ob das so stimmt.
Neue Frage »
Antworten »
    Foren-Übersicht -> Genetik

Verwandte Themen - die Neuesten
 Themen   Antworten   Autor   Aufrufe   Letzter Beitrag 
Keine neuen Beiträge DNA- Primer 1 Alex_D 1392 29. Jan 2017 15:25
PaGe Letzten Beitrag anzeigen
Keine neuen Beiträge degenerierte Primer und flankierende Primer 1 marmar 2872 20. Aug 2015 23:18
Firelion Letzten Beitrag anzeigen
Keine neuen Beiträge Was bedeutet oFUM bei Primer? 0 Gast 882 13. Aug 2015 23:57
Hammy Letzten Beitrag anzeigen
Keine neuen Beiträge Warum benötigt man einen Primer bei der Replikation? Besitzt 1 fawr13 1150 13. Jun 2015 23:42
Firelion Letzten Beitrag anzeigen
Keine neuen Beiträge Primer 3 Seehund 1209 10. Sep 2013 22:44
jörg Letzten Beitrag anzeigen
 

Verwandte Themen - die Größten
 Themen   Antworten   Autor   Aufrufe   Letzter Beitrag 
Keine neuen Beiträge Primer 9 anny12 4121 26. Okt 2011 00:24
PaGe Letzten Beitrag anzeigen
Keine neuen Beiträge Wie findet man den Primer bei PCR ? 8 prisma 6667 31. März 2012 15:17
jörg Letzten Beitrag anzeigen
Keine neuen Beiträge HILFE HILFE PRIMER 8 Aloscita 4281 14. Jul 2008 16:48
Bert Letzten Beitrag anzeigen
Keine neuen Beiträge Fragen zu (Primer/PCR-Methode/DNA/....) 6 >*KiBi*< 3523 30. Nov 2006 21:03
Noctu Letzten Beitrag anzeigen
Keine neuen Beiträge Primer 4 Bioline 2634 08. Feb 2007 21:38
M!cha Letzten Beitrag anzeigen
 

Verwandte Themen - die Beliebtesten
 Themen   Antworten   Autor   Aufrufe   Letzter Beitrag 
Keine neuen Beiträge Wie findet man den Primer bei PCR ? 8 prisma 6667 31. März 2012 15:17
jörg Letzten Beitrag anzeigen
Keine neuen Beiträge RNA Primer AM LEITSTRANG auch entfernt? (REPLIKATION) 3 biofreak123 5160 02. Nov 2010 20:31
PaGe Letzten Beitrag anzeigen
Keine neuen Beiträge HILFE HILFE PRIMER 8 Aloscita 4281 14. Jul 2008 16:48
Bert Letzten Beitrag anzeigen
Keine neuen Beiträge Primer 9 anny12 4121 26. Okt 2011 00:24
PaGe Letzten Beitrag anzeigen
Keine neuen Beiträge Fragen zu (Primer/PCR-Methode/DNA/....) 6 >*KiBi*< 3523 30. Nov 2006 21:03
Noctu Letzten Beitrag anzeigen