RegistrierenRegistrieren    LoginLogin   FAQFAQ    SuchenSuchen   
PCR, RFLP, VNTR,STR, southern-blotting
 
Neue Frage »
Antworten »
    Foren-Übersicht -> Genetik
Autor Nachricht
nagron123
Gast





BeitragVerfasst am: 02. März 2014 22:17    Titel: PCR, RFLP, VNTR,STR, southern-blotting Antworten mit Zitat

Meine Frage:
Hallo :)

Meine Frage ist worin genau sich die oben genannten Methoden unterscheiden/ welche wann angewendet werden

Also bis jetzt habe ich es so verstanden:
Bei der PCR werden Primer hergestellt(??), dann mit Enzymen und Nucleotiden usw. und der DNA vermischt werden. Primer setzen immer nur an bestimmten Stellen der DNA an (z.B. vor und hinter den loci?) und vervielfältigen diese dann.

VNTR und STR unterscheiden sich nur in der Anzahl der Wiederholungen der Sequenzen.

Beim RFLP wird die DNA durch Restriktionsenzyme an verschiedenen Stellen geschnitten.
Hat die Methode auch was mit den loci zu tun?
Muss hier auch PCR angewendet werden? sonst hätte man doch zu wenig DNA oder? Und wieso kann man hierdurch z.B. eine Vaterschaft herausfinden. In den nicht-codierenden Bereichen der DNA kommen doch relativ häufig Mutationen vor, d.h. beim Kind könnte ein ganz anderes Bandenmuster entstehen als beim Vater
Und allgemein wo liegt der Unterschied zu VNTR/ STR? Werden diese nicht mit Restriktionsenzymen behandelt?

Southern-Blotting: Hier werden die DNA Fragmente auf eine Folie übertragen. Man gibt radioaktiv markierte Gensonden hinzu, die an komplementäre Sequenzen binden. Woher weiß man denn die Sequenzen, da sie ja bei jedem Menschen anders sind? Ist das Blotting einfach dazu da die DNA sichtbar zu machen? In meinem Bio Buch steht nämlich, dass heute darauf verzichtet wird, wenn man die DNA mit PCR amplifiziert und dass es dabei automatisch individuell verschiedene DNA Fragmente gäbe. Habe ich da jetzt komplett was falsch verstanden?

Meine Ideen:
Meine Ansätze habe ich oben ja schon genannt, auf meine Fragen habe ich bis jetzt keine Antwort finden können.
Firelion



Anmeldungsdatum: 27.08.2009
Beiträge: 1878

BeitragVerfasst am: 02. März 2014 23:17    Titel: Antworten mit Zitat

Hi,


zur PCR: Die Primer vervielfältigen die DNA nicht sondern sind notwendig, damit das Enzym die Sequenz verfielfältigen kann. Aber ja: sie bestimmen welches Stück vervielfältigt wird.

Das Southern Blotting nutzt man dazu bestimmte Genfragmente nachzuweisen. Das stammt aus einer Zeit in der es noch keine PCR gab. Bevor man die DNA blottet also auf eine Membran überträgt, trennt man die DNA Stücke nach ihrer Größe auf (Gelelektrophorese). Dann kannst du aber nur sehen, ob du DNA Stücke in üpassender Größe hast, weißt aber nicht welche Sequenz diese haben also, ob sie die richtigen sind. Nach dem blotten kannst du die DNA Sequenzen spezifisch markieren (mit Radioaktiven bzw. heutzutage auf fluoreszenz markierten Sonden) und weißt dann, ob das wirklich das passende Fragment ist.

Das macht mabn heute tastsächlich selten (zumindest im Lasboralltag), weil man heute die DNA Sequenzen die einen interesssieren tzatsächklich spezofisch mit einer PCR verfielfältigen kann und hinterher gegebenfalls sequenzieren.

Na ja, der größte Teil der DNA ist bei den Menschen identische 8soghasr unter den Säugern). Die DNA untetschridet sich in nur in einem geringen Prozentsatz.

Gehts es dir um Vaterschaftstests bzw den genetischen Fingerabdruck?

Für RFLP, VNTR und STR muss masn im allgemeinen wissen, wonach man sucht (auch früher konnte man Sequenzieren (es war nur zeitaufwändiger und teurer). Hier unterschriden sich die Menschen auch nicht in der Abfolge der einzelnen Basen sondern in der Größe der Fragmente:

RFLP: Wurde das Fragment gersxchnitten (also zwei Banden oder nicht(eine Bande) und VNTR+ STR wie viele Repats gibt es wie lange ist also die Sequenz).

Wenn du mit dem Southernblot zum Beispiel VNTR nachweisen willst, würdest du eine Sonde nehmen die die Sequenz des Repeats erkernnt. Einer SOnde die komplementär zu GATCGATC ist würde sowohl GATCGATCGATCGATCGATC als auch GATCGATCGATCGATC erkennen. Im ersten Fall würde die BAnde aber etwas weiter oben (weil das Stück 5 GATC groß ist) als im zweiten Fall laufen. Da sagt dir dann die Höhe der Bande im Blot, wie viele Repeats du hast.

Heute kann man mit der PCR (durch Auswahl der Primer) nur die Sequenz verfielfältigen die dich interessiert und dann die GRöße dieser durch Gelelektrophorse bestimmen. Hier braucht man keine Sondern, weil nur die Seqiernz die dich interessiert in größere Anzahl vorhanden ist. Wenn man es ganz genau wissen will sequenziert man dann die verfielfältigte Sequenz.


LG Firelion

_________________
It is well known that a vital ingredient of success is not knowing that what you’re attempting can’t be done - Terry Pratchett
nagron123
Gast





BeitragVerfasst am: 03. März 2014 12:54    Titel: Antworten mit Zitat

Firelion hat Folgendes geschrieben:

Bevor man die DNA blottet also auf eine Membran überträgt, trennt man die DNA Stücke nach ihrer Größe auf (Gelelektrophorese). Dann kannst du aber nur sehen, ob du DNA Stücke in üpassender Größe hast, weißt aber nicht welche Sequenz diese haben also, ob sie die richtigen sind. Nach dem blotten kannst du die DNA Sequenzen spezifisch markieren (mit Radioaktiven bzw. heutzutage auf fluoreszenz markierten Sonden) und weißt dann, ob das wirklich das passende Fragment ist.


aber die DNA teilt sich doch nur auf wenn man sie vorher mit Restriktionsenzymen behandelt hat oder? und dann weiß man doch welche stücke man erhält

Firelion hat Folgendes geschrieben:

Das macht mabn heute tastsächlich selten (zumindest im Lasboralltag), weil man heute die DNA Sequenzen die einen interesssieren tzatsächklich spezofisch mit einer PCR verfielfältigen kann und hinterher gegebenfalls sequenzieren.


Man sucht sich also Primer die "neben" bestimmten loci ansetzten und die Polymerasen vervielfältigen dann nur diese Stücke? man braucht also keine restriktionsenzyme?


Firelion hat Folgendes geschrieben:

RFLP: Wurde das Fragment gersxchnitten (also zwei Banden oder nicht(eine Bande) und VNTR+ STR wie viele Repats gibt es wie lange ist also die Sequenz).

Den teil versteh ich nicht ganz ..
Hilfe
Firelion



Anmeldungsdatum: 27.08.2009
Beiträge: 1878

BeitragVerfasst am: 03. März 2014 14:02    Titel: Antworten mit Zitat

Bevor man das macht schneidet man die DNA in Stücke,ja.
Wenn man genomische DNA direkt auf ein Gel gibt, bekommt man einen Schmier anstatt definierter Banden.
Eine Gelelektrophorese trennt die Fragmente nur nach Größe, sagt ja also nichts über die Sequenz aus.

GATC, GACC, GAAC und GAAG könnte man mit einer Gelelektrophorese z.B. nicht auseinander halten. Deshalb markiert man in einem Southernblot (der nach einer Gelelektrophorese kommt) die Sequenz die dich interessiert.

Für eine PCR braucht man keine Restriktionsenzyme.

RFLP basiert darauf, dass durch Punktmutationen Erkennubngssequenzen für eine Restriktionsenzym neu auftreten bzw verloren gehen können und somit das Restriktionsenzym schneiden kann oder nicht.

Wenn ein Enzym zum Beispiel die Sequenz GTAC erkennt und schneidet könnten die Fragmente GT und AC entsthen. Ist jetzt eine PUnktmutation vorhanden z.B. GTAA stat GTAC schneidet das Enzym nicht mehr.

Wenn man jetzt zwei Mal GTAC hat und das Enzym dazu gibt ist die Bande im Gel weiter unten als beio zwei Kopien von GTAA (weil Nukleotide größer sind als zwei Nukleotide). Hat man eine Kopie von GTAC und reiner von GTAA erhält man im Gel zwei Banden, weil dfie eine geschnitten wurde und die andere nicht. Das sieht dann so aus:

http://www.ncbi.nlm.nih.gov/projects/genome/probe/IMG/RFLP_genotyping.gif


VNTR und STR basieren darauf, dass unterschiedliche Menschen unterschiedlich viele Repeats haben. Wenn jemand
5 Wiederholungen eines Repeats hat erhälst du eine Ande weiter unten als, wenn jemand 10Wiederhilungen des Repeats hat.



Also du hast im Prinzip zwei Möglichkeiten:

Entweder du hackst die gesamte genomische DNA klein, trennst sie nach Größe auf, packst sie auf eine Membran und markierst dann die Sequenz die dich interessiert (Sothern Blot), oder du verfielfältigst die Sequenz die dich interessiert und trennst die Fragmente nach Größe auf (PCR).

Bei alle diesen Verfashren kennast du die Sequenz die dich interssiert bereits und kannst daher Sonden bzw Primer herstzellen. Du weißt auch dass deine Enzyme, die du beim zerschneriden der DNA vorm Blotten verwendest nicht die Repeats zerschneiden.

Will man des nicht für den Vaterschaftstest bw den genetischen Fingerabdruck sondern für die Forscbhung verwenden, kennt masn die Sequenz ebenfalls.

_________________
It is well known that a vital ingredient of success is not knowing that what you’re attempting can’t be done - Terry Pratchett
nagron123
Gast





BeitragVerfasst am: 03. März 2014 23:12    Titel: Antworten mit Zitat

Firelion hat Folgendes geschrieben:


Also du hast im Prinzip zwei Möglichkeiten:

Entweder du hackst die gesamte genomische DNA klein, trennst sie nach Größe auf, packst sie auf eine Membran und markierst dann die Sequenz die dich interessiert (Sothern Blot), oder du verfielfältigst die Sequenz die dich interessiert und trennst die Fragmente nach Größe auf (PCR).


Und weil man die DNA mit PCR vervielfältigt hat, ist sie groß genug um sie zu sehen? also brauch man keine Sonden mehr?

Und man betrachtet immer nur die loci oder? es gibt ja auch Polymorphismen ( Sequenzunterschiede?), wodurch man ( wenn man Restriktionsenzyme anwendet) bei jedem Menschen ein unterschiedliches Muster erhält. Also muss man zwischen den Beiden "Sachen" unterscheiden?
Und wie könnte man durch das zweite z.B. eine Vaterschaft nachweisen? Das Kind könnte doch Mutationen im nicht-codierenden Bereich haben und dann könnte ein komplett anderes Bandenmuster heraus kommen?
Firelion



Anmeldungsdatum: 27.08.2009
Beiträge: 1878

BeitragVerfasst am: 03. März 2014 23:51    Titel: Antworten mit Zitat

Die PCR verändert die Größe des Fragments nicht. Sie verfielfältigt aber spezifisch das Fragmet welches du willst.

Angenommen du nimmst die gesamte genomische DNA und gibts da einen Restruktionsenzym mix drauf, dann erhälst du z.B. 100 Fragmente unterschiedlicher Sequenz die alle 45 bp groß sind. Dich interessiert jetzt aber nur ein ganz bestimmtes 45 bp großes Fragment. Im Gel siehst du jetzt auch eine Bande bei 45 bp, weißt aber leider nicht, ob das Fragment was dich interessiert dabei ist oder nicht. Deshalb nimmst du jetzt eine Sonde die nur das Fragment bindet welches dich interessiert. Siehst du dann im Blot eine Bande bei 45bp weißt du, dass dein Fragment vorhanden ist.

Heute kannst du aber auch einfach die genomische DNA nehmen und mittels PCR die Sequenz die dich interessiert ganz stark vervielfältigen. Wenn du dann im Gel eine Bande bei 45 bp siehst, weißt du dass es das Fragment ist was dich interessiert.

Das mittels PCR anstatt Southern Blot zu machen hat gewisse Vorteile:
Du brauchst keine Radoaktivität, es geht schneller, es ist weniger arbeitsintensiv und du brauchst weniger DNA um überhaupt etwas sehen zu können.

Zu den Mutationen:

Naja, ob kofierend oder nicht kodierend ist für diese Verfahren egal, da du weder RNA noch Proteine verwendest.

Mit RFLP kannst du nur Polymorphismen nachwweisen, die dazu führen, dass Erkennungssequenzen hinzukommen oder verschwinden.
Wenn zum Beispiel ATAT und ATTT erkennt werden würden und ATCT und ATGT nicht, könntest du nicht sagen welche Version vorliegt. Du weißt nur, dass wenn das Fragment geschnitten wird liegt entweder ATAT oder ATTT vor und wenn nicht geschnitten wird entweder ATCT oder ATGT.
Wenn du es genauer wissen wollen würdest, müsstest du hinterher sequenzieren.

Mit VNTR und STR kannstz du nur längere oder kürzere Repeats nachweisen. Das heißt du könntest zwar den Unterschied zwischen ATATGCATGCATGCATGC und ATATGCATGC sehen aber nicht den Unterschied zwischen ATATGCATGC und GTATGCATGC.


Zum Vaterschaftstest: Jeder Menschen hat hinsichtlicher dieser Merkmale zwei Allele und erbt eines von der Mutter und eines vom Vater.
Das heißt ein Kind sollte für jedes Merkmal ein Allel vom Vater haben. Wenn man dann ausreichend viele Loci untersucht, weiß man im allgemeine ob es der Vater ist oder nicht.

Für Vaterschaftstests und den genetischen Fingerabdruck werden nuir nicht kodierende Bereiche der DNA verwendet. Eineiige Zwillinge habe den gleichen genetischen Fingerabdruck (zumindest zum Zeitpunkt ihrer Trennung).

_________________
It is well known that a vital ingredient of success is not knowing that what you’re attempting can’t be done - Terry Pratchett
Neue Frage »
Antworten »
    Foren-Übersicht -> Genetik

Verwandte Themen - die Neuesten
 Themen   Antworten   Autor   Aufrufe   Letzter Beitrag 
Keine neuen Beiträge PCR 4 VieleFragezeichen 2072 20. Sep 2018 14:36
Blipt1960 Letzten Beitrag anzeigen
Keine neuen Beiträge Unterschied zwischen STR/VNTR und RFLP bei der Genanalyse? 1 Gast 4527 05. Jan 2018 18:45
PaGe Letzten Beitrag anzeigen
Keine neuen Beiträge Produktgröße PCR 2 cajo 2108 01. März 2017 20:39
cajo Letzten Beitrag anzeigen
Keine neuen Beiträge Megaprimer PCR 1 Aloscita133333 1721 15. Dez 2016 15:32
jörg Letzten Beitrag anzeigen
Keine neuen Beiträge Polymerase Kettenreaktion (PCR) sinnvoll? 2 xdcobra11 1617 06. Mai 2016 17:52
xdcobra11 Letzten Beitrag anzeigen
 

Verwandte Themen - die Größten
 Themen   Antworten   Autor   Aufrufe   Letzter Beitrag 
Keine neuen Beiträge PCR 67 benno67 15467 09. Nov 2011 23:24
jörg Letzten Beitrag anzeigen
Keine neuen Beiträge Wie findet man den Primer bei PCR ? 8 prisma 7568 31. März 2012 15:17
jörg Letzten Beitrag anzeigen
Keine neuen Beiträge PCR-Methode? 7 Gast 10030 30. Okt 2012 17:07
Jenny_fragt Letzten Beitrag anzeigen
Keine neuen Beiträge southern-blotting 6 ka boga 3607 15. Jan 2007 12:58
M!cha Letzten Beitrag anzeigen
Keine neuen Beiträge Gelelektrophorese und PCR 5 Joline 10511 25. Feb 2008 18:52
revilo Letzten Beitrag anzeigen
 

Verwandte Themen - die Beliebtesten
 Themen   Antworten   Autor   Aufrufe   Letzter Beitrag 
Keine neuen Beiträge PCR 67 benno67 15467 09. Nov 2011 23:24
jörg Letzten Beitrag anzeigen
Keine neuen Beiträge Gelelektrophorese und PCR 5 Joline 10511 25. Feb 2008 18:52
revilo Letzten Beitrag anzeigen
Keine neuen Beiträge PCR-Methode? 7 Gast 10030 30. Okt 2012 17:07
Jenny_fragt Letzten Beitrag anzeigen
Keine neuen Beiträge PCR- Verfahren 4 Djudje 10010 22. Jan 2009 01:23
Djudje Letzten Beitrag anzeigen
Keine neuen Beiträge Wie findet man den Primer bei PCR ? 8 prisma 7568 31. März 2012 15:17
jörg Letzten Beitrag anzeigen