RegistrierenRegistrieren    LoginLogin   FAQFAQ    SuchenSuchen   
DNA aus Codesonne ablesen?
 
Neue Frage »
Antworten »
    Foren-Übersicht -> Genetik
Autor Nachricht
Gast






BeitragVerfasst am: 19. Feb 2006 16:09    Titel: DNA aus Codesonne ablesen? Antworten mit Zitat

Also hab mal ne Frage...

Angenomen ich hab ne Aminosäurensequenz, z.b. Gly Sen Lys.

So, dann isses ja kein großer Akt, die mRNA bzw. die Basentriplets mithilfe der Codesonne abzulesen. Aber wie bekomm ich jetzt aus der mRNA die DNA??

Mir ist schon klar, dass man einfach die komplementären Basen aufschreiben kann und dabei eben den unterschied mit Uracil beachten sollte.

Aber mal zu meinem Problem: Die mRNA ist ja schließlich von 5' zu 3' und wie übersetze ich dies jetzt in die DNA? Muss ich die DNA dann einfach aufschreiben und dann das 3' ende vorne hinsetzen? Oder muss ich die DNA irgendwie entgegen der lesrichtung also dann von rechts notieren? Hilfe

Hoffe ihr versteht meine frage...



Danke schonma fürs helfen

vernice
chefin
Organisator


Anmeldungsdatum: 28.04.2004
Beiträge: 1551
Wohnort: Oberhausen

BeitragVerfasst am: 19. Feb 2006 17:12    Titel: Antworten mit Zitat

Du hast das Problem selbst gelöst. Beachte die Lesrichtung
_________________
Wissen ist Macht, Nichtwissen macht machtlos
Gast






BeitragVerfasst am: 19. Feb 2006 18:23    Titel: Antworten mit Zitat

aaaaha....ja was bedeutet das denn jetzt genau?

Vielleicht mal an nem Beispiel:

meine mRNA lautet z.b.: 5' CUG GUG AGC AAU CAC 3'

ok und wie lautet dann die DNA??? ,
also einfach dann so??: 3' GAC CAC TCG TTA GTG 5'

Habs immer noch nich so ganz geblickt...bitte bisschen konkretere antwort, aber trotzdem danke...
KrK
Gast





BeitragVerfasst am: 22. Feb 2006 13:32    Titel: Antworten mit Zitat

konkrete antwort:

Ja. Richtig.
Gast






BeitragVerfasst am: 11. März 2006 18:51    Titel: HILFE Antworten mit Zitat

Schreibe am Montag ne Klausur und hab da thema mit der Codesonne garnicht verstanden!
Wenn ich jetzt ne DNA habe ,die lautet: ATG CCA TGC wie komme ich dann auf die m-RNA??? Hilfe Hilfe Hilfe
arabidopsis



Anmeldungsdatum: 21.04.2005
Beiträge: 37

BeitragVerfasst am: 11. März 2006 20:09    Titel: T und U Antworten mit Zitat

Hallo,
ohne nun die Mechanismen der Transcription zu erklären:
Ersetze jedes T (Thymin) der DNA-Sequenz durch ein U (Uracil) und Du erhältst die RNA-Sequenz.

Viel Erfolg!
Gast






BeitragVerfasst am: 11. März 2006 21:25    Titel: Antworten mit Zitat

Anonymous hat Folgendes geschrieben:
aaaaha....ja was bedeutet das denn jetzt genau?

Vielleicht mal an nem Beispiel:

meine mRNA lautet z.b.: 5' CUG GUG AGC AAU CAC 3'

ok und wie lautet dann die DNA??? ,
also einfach dann so??: 3' GAC CAC TCG TTA GTG 5'

Habs immer noch nich so ganz geblickt...bitte bisschen konkretere antwort, aber trotzdem danke...


ist dann der nicht-codegene strang einfach 5' CTG GTG AGC AAT CAC 3' ?
arabidopsis



Anmeldungsdatum: 21.04.2005
Beiträge: 37

BeitragVerfasst am: 12. März 2006 00:14    Titel: Antworten mit Zitat

Richtig!
unterkurs
Gast





BeitragVerfasst am: 15. Jan 2010 16:31    Titel: Antworten mit Zitat

ich verstehe das auch nicht so ganz
wie kann man mit hilfe der code sonne ein protein in DNA umwandeln?
z.B. 5´ATGTTCTCAATCAGCACCTTTGTGGTTCATAG3´
PaGe
Moderator


Anmeldungsdatum: 19.03.2007
Beiträge: 3551
Wohnort: Hannover

BeitragVerfasst am: 15. Jan 2010 17:52    Titel: Antworten mit Zitat

Protein in DNA :gruebel: Du meinst sicherlich DNA->Protein.

1. DNA in mRNA übersetzen. Einfach komplementäre Base aufschreiben und T durch U ersetzen.
Wie oben schon erwähnt, ist die "Leserichtung" - also 3' und 5' - genau entgegengesetzt der DNA
2. Dann das Starttriplett AUG suchen.
3. AUG im CodeSonne nachschauen und Methionin als AS herausbekommen.
4. Und dann Triplettweise die mRNA weitwandern.
Das erfordert ein wenig Übung.

_________________
Die deutsche Rechtschreibung ist Freeware, du darfst sie kostenlos nutzen. Aber sie ist nicht Open Source, d. h., du darfst sie nicht verändern oder in veränderter Form veröffentlichen.
chefin
Organisator


Anmeldungsdatum: 28.04.2004
Beiträge: 1551
Wohnort: Oberhausen

BeitragVerfasst am: 15. Jan 2010 19:48    Titel: Antworten mit Zitat

Doch, es geht natürlich auch, dass man ein Protein in DNA umschreibt. Das ist jedoch nicht eineindeutig, da - wie bekannt - der genetische Code degeneriert ist, d.h. für eine Aminosäure mehrere Codons codieren. Für Serin beispielsweise 6 Codons, wenn ich das richtig im Kopf habe.
_________________
Wissen ist Macht, Nichtwissen macht machtlos
PaGe
Moderator


Anmeldungsdatum: 19.03.2007
Beiträge: 3551
Wohnort: Hannover

BeitragVerfasst am: 15. Jan 2010 21:22    Titel: Antworten mit Zitat

Dann passt es aber nicht, dass er eine DNA-Sequenz angibt Zwinkern
_________________
Die deutsche Rechtschreibung ist Freeware, du darfst sie kostenlos nutzen. Aber sie ist nicht Open Source, d. h., du darfst sie nicht verändern oder in veränderter Form veröffentlichen.
chefin
Organisator


Anmeldungsdatum: 28.04.2004
Beiträge: 1551
Wohnort: Oberhausen

BeitragVerfasst am: 16. Jan 2010 19:01    Titel: Antworten mit Zitat

Nee, da hast du natürlich Recht Thumbs up! Aber wie gesagt, generell wäre es möglich mit dem entsprechenden Polypeptid. Wink
_________________
Wissen ist Macht, Nichtwissen macht machtlos
ajnom
Gast





BeitragVerfasst am: 09. Feb 2010 15:41    Titel: Antworten mit Zitat

aber wie kann ich anhand der aminosäuren die dna bestimmen?? das soll ich in einer aufgabe machen, versteh aber nicht wie das geht!
PaGe
Moderator


Anmeldungsdatum: 19.03.2007
Beiträge: 3551
Wohnort: Hannover

BeitragVerfasst am: 09. Feb 2010 20:02    Titel: Antworten mit Zitat

Das geht zwar, ist aber nicht eindeutig. Es gibt mehrere DNA-Sequenzen, die für dasselbe Protein codieren.

In diesem Fall musst du einfach rückwärts denken. Gib einmal eine AS-Sequenz an.

_________________
Die deutsche Rechtschreibung ist Freeware, du darfst sie kostenlos nutzen. Aber sie ist nicht Open Source, d. h., du darfst sie nicht verändern oder in veränderter Form veröffentlichen.
Neue Frage »
Antworten »
    Foren-Übersicht -> Genetik

Verwandte Themen - die Neuesten
 Themen   Antworten   Autor   Aufrufe   Letzter Beitrag 
Keine neuen Beiträge DNA, Antibiotika 3 MR 199 11. Mai 2021 13:05
Bio-Gast Letzten Beitrag anzeigen
Keine neuen Beiträge Von der DNA zum Merkmal ein Begriffsnetz 0 Annanas 3598 15. Okt 2019 11:38
Annanas Letzten Beitrag anzeigen
Keine neuen Beiträge Verändert sich sich die DNA? Stammzelltransplantation 0 Gast 2053 02. Jan 2019 10:14
Anolised Letzten Beitrag anzeigen
Keine neuen Beiträge Dna Replikation - Dna Polymerase 2 Gast 3729 10. Okt 2018 10:36
Blipt1960 Letzten Beitrag anzeigen
Keine neuen Beiträge Human DNA vs. other species 0 JoeClark 5323 23. Nov 2017 06:37
JoeClark Letzten Beitrag anzeigen
 

Verwandte Themen - die Größten
 Themen   Antworten   Autor   Aufrufe   Letzter Beitrag 
Keine neuen Beiträge DNA/DNS 21 simsespätzle 22958 23. Nov 2005 21:51
chefin Letzten Beitrag anzeigen
Keine neuen Beiträge DNA Isolation 16 Barney 11401 04. Jan 2012 13:13
PaGe Letzten Beitrag anzeigen
Keine neuen Beiträge DNA - was kann man alles in ihr lesen ??? 16 Jens 13802 23. Aug 2005 20:26
Karon Letzten Beitrag anzeigen
Keine neuen Beiträge DNA bei roten blutkörperschen 14 FatRandy 14417 25. Nov 2008 19:47
FatRandy Letzten Beitrag anzeigen
Keine neuen Beiträge DNA Verändern 12 Mackie 12448 10. März 2012 21:36
PaGe Letzten Beitrag anzeigen
 

Verwandte Themen - die Beliebtesten
 Themen   Antworten   Autor   Aufrufe   Letzter Beitrag 
Keine neuen Beiträge DNA in m-RNA und t-RNA umwandeln - Aufgabe 10 ketzchen 73622 16. Jan 2017 15:50
PaGe Letzten Beitrag anzeigen
Keine neuen Beiträge m.H. der Codesonne die Basensequenz übersetzen 12 estrella 46823 12. Dez 2004 20:19
Gast Letzten Beitrag anzeigen
Keine neuen Beiträge Unterschied zwischen RNA und DNA? 3 Cedro 35382 16. Apr 2010 19:02
PaGe Letzten Beitrag anzeigen
Keine neuen Beiträge Aufbau der DNA 5 Zilla 35046 08. Nov 2010 22:35
nanana Letzten Beitrag anzeigen
Keine neuen Beiträge DNA/DNS 21 simsespätzle 22958 23. Nov 2005 21:51
chefin Letzten Beitrag anzeigen